Journal of Histochemistry and Cytochemistry, Vol. 46, 707-716, June 1998, Copyright © 1998, The Histochemical Society, Inc.
Rat Endocrine Pancreatic Development in Relation to Two Homeobox Gene Products (Pdx-1 and Nkx 6.1)
Anne Østera,
Jan Jensenb,
Palle Serupb,
Philip Galanteb,
Ole D. Madsenb, and
Lars-Inge Larssona
a Department of Molecular Cell Biology, Statens Seruminstitut, Copenhagen
b Hagedorn Research Institute, Gentofte, Denmark
Correspondence to:
Lars-Inge Larsson, Dept. of Molecular Cell Biology, Statens Seruminstitut, Artillerivej 5, Bldg. 81, DK-2300 Copenhagen S, Denmark.
 |
Summary |
|---|
We studied the distribution of the homeodomain proteins Pdx-1 and Nkx 6.1 in the developing rat pancreas. During early development, nuclear staining for both Pdx-1 and Nkx 6.1 occurred in most epithelial cells of the pancreatic anlage. Subsequently, Nkx 6.1 became more ß-cell-restricted, and Pdx-1 also occurred in other islet cell types and in the duodenal epithelium. During early pancreatic development, cells co-storing insulin and glucagon were regularly detected. The vast majority of these did not possess nuclear staining for either Pdx-1 or Nkx 6.1. Subsequently, cells storing insulin only appeared. Such cells displayed strongly Pdx-1- and Nkx 6.1-positive nuclei. Therefore, Nkx 6.1, like Pdx-1, may be an important factor in pancreatic development and in mature insulin cell function.
(J Histochem Cytochem 46:707715, 1998)
Key Words:
homeodomain proteins, Nkx 6.1, Pdx-1, insulin, pancreatic polypeptide, glucagon
 |
Introduction |
|---|
The pancreas develops as two buds (the ventral and dorsal anlage) emanating from the primitive foregut, which grow and fuse to form the adult pancreas (Spooner et al. 1970
; Pictet and Rutter 1972
). In the developing mouse pancreas, cells co-storing insulin and glucagon are detected, and it has been suggested that mature islet cell types develop over such multihormonal stages (Alpert et al. 1988
). Even though this lineage theory of development has been challenged (Herrera et al. 1994
; Pang et al. 1994
), there is solid evidence for the existence of insulin and glucagon co-storing cells during mammalian pancreatic development (Hashimoto et al. 1988
; de Krijger et al. 1992
; Lukinius et al. 1992
; Teitelman et al. 1993
; Larsson and Hougaard 1994
; Upchurch et al. 1994
). Moreover, double in situ hybridizations have documented that developing human pancreatic endocrine cells simultaneously express the insulin and glucagon genes (Larsson and Hougaard 1994
). It is therefore of interest to determine how the expression of islet cell transcription factors relates to such multihormonal phenotypes.
Recently, a mouse homeobox protein, insulin promoter factor 1 (ipf1), was found to be required for development of the murine pancreas (Jonsson et al. 1994
; Offield et al. 1996
). In addition, ipf1 may be important in regulating the transcription of the insulin genes (Ohlsson et al. 1993
; Peers et al. 1994
; Petersen et al. 1994
; Serup et al. 1995
, Serup et al. 1996
). Ipf1 is homologous to the rat homeobox gene product stf1/idx1 (Leonard et al. 1993
; Miller et al. 1994
) and to the Xenopus laevis homeobox 8 (Peshevaria et al. 1994
), and these proteins are now collectively referred to as pancreatic duodenal homeobox gene 1 (Pdx-1) (Stein et al. 1996
). Homeobox proteins are involved in cell differentiation and tissue determination. A search for new homeobox genes in an insulinoma cDNA library led to the finding of several such genes, one of which (Nkx 6.1) appeared to have an islet cell-restricted distribution (Rudnick et al. 1994
). Recent studies have revealed a ß-cell-specific expression of Nkx 6.1 in the adult rat pancreas and have detected activation of this gene during progression of islet tumor cells to an insulin-producing phenotype (Jensen et al. 1996
).
We decided to study the development of the islet hormone-producing cells in the rat pancreas in relation to the development of Pdx-1- and Nkx 6.1-immunore-active cells to determine the relation of these homeo-box gene products to specific hormonal phenotypes.
 |
Materials and Methods |
|---|
Animals
Wistar rats (Pan:WIST; The Panum Institute, Copenhagen, Denmark) were mated overnight; noon of the day on which the vaginal plug was discovered was considered as Day 0.5 of gestation (E0.5). Pregnant female rats were sacrificed by CO2 and the fetuses were immersion-fixed overnight in 4% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.4. With embryos older than E16.5, the abdominal cavity was opened before fixation. Rat embryos were examined at E11.0, E11.5, and at 1-day intervals from E11.5 to E20.5. Pancreases from postnatal rats 113 days of age (P1P13) were immersion-fixed overnight. Adult rats were intracardially perfused with the fixative and the pancreas immersion-fixed for 120 hr. Whole E11.0 and E11.5 embryos, the pancreatic region of E12.5 to E14.5 embryos, and the splenic and duodenal pancreases of E15.5 and older animals were cryoprotected overnight in 30% sucrose, mounted in Tissue-Tek, and frozen in N-hexane cooled by liquid nitrogen. Pancreatic tissue for RNA extraction was immediately transferred to 100 µl RNAzol extraction solution (Cinna/Biotecx; Houston, TX), homogenized, and RNA extracted as described by the manufacturer. At the earliest stage (E13.5), we obtained 2 µg total RNA from one full litter. At later stages, total yield increased.
Multiplex RT-PCR
Random-primed cDNA synthesis and multiplex RT-PCR were performed as described earlier (Jensen et al. 1996
). Primer sequences for Nkx 6.1 (284 BP), Pdx-1 (224 BP), TBP (TATA-binding protein) (190 BP), insulin (312 BP) (these primers amplify both rat insulin I and II), and tubulin (250 BP), were as described (Jensen et al. 1996
). Primer sequences used to amplify rat glialtestis homeobox (Gtx) (160 BP; sequences derived from mouse Gtx, Genbank Acc. MUSGTX.GB_RO) were: upstream, TTTAGCCGCGCTGCACAACAT; downstream, CACCGGCCGTCCCAGCATGTC. This primer set amplifies rat and mouse Gtx to amplicons of the same size. Quantitation of product yield was performed by a Molecular Dynamics series 400 phosphorimager, as described (Jensen et al. 1996
).
Immunocytochemistry
Sections of 35 µm were stained by indirect immunofluorescence using rabbit antisera to recombinant glutathione-S-transferase (GST) fusion proteins incorporating either the C-terminal region of Pdx-1 (stf1) (Ab. 1856-5) or the C-terminal region of Nkx 6.1 (Ab. 174) (Jensen et al. 1996
). The recombinant proteins were produced in bacteria and purified by affinity chromatography on glutathione columns. The GST-Pdx-1 expression plasmid was a kind gift from Dr. J. Leonard (StrangCornell Research Laboratory; New York, NY) (Peers et al. 1994
). In addition, sections were stained with rabbit antisera to glucagon (No. 4316; a kind gift from Dr. J.J. Holst, Department of Physiology, University of Copenhagen, Denmark), human pancreatic polypeptide (HPP, #615-1054B-248-4; kindly donated by Dr. R.E. Chance, Eli Lilly Co., Indianapolis, IN), guinea pig anti-insulin serum (recognizes both rat insulin I and II) (DAKO A/S; Glostrup, Denmark), and mouse monoclonal antisera to glucagon (GLU 001) or somatostatin (SOM018) (both from NovoClone; Novo-Nordisk, Bagsvaerd, Denmark) as previously detailed (Larsson et al. 1975
, Larsson et al. 1976b
; Jackerott et al. 1996
). For double and triple immunofluorescence, mixtures of primary antibodies raised in different species were used for staining and detection was achieved by species-specific secondary antibodies conjugated to fluorescein isothiocyanate (FITC), Texas Red, amino-methylcoumarine (AMCA), or biotin (Jackson Immuno-Research Laboratories, West Grove, PA; DAKO A/S and Statens Bakteriologiska Laboratorium, Stockholm, Sweden). The biotin-conjugated antibodies were detected with AMCA-conjugated streptavidin (Vector Laboratories; Burlingame, CA). The secondary antibodies were absorbed overnight with 10 µl/ml normal serum from the species recognized by the other secondary antisera, with 10 µl/ml of normal serum from the species donating the other secondary antibodies (when applicable), and with 10 µl/ml normal rat serum.
Triple immunostainings for confocal microscopy were performed as above except that Cy5-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories) was used instead of AMCA-labeled antibody. The confocal laserscan microscope (Molecular Dynamics; Sunnyvale, CA) was equipped with a x100, n.a. 1.40 Nikon objective and an argon/krypton laser. Scans were taken using a lateral xy resolution of 0.13 µm and a z resolution of 0.39 µm. In this way, hormone and homeobox protein coexistence could be established in thin optical sections.
For quadruple stainings, sections were first stained for Nkx 6.1 or Pdx-1 by the peroxidaseanti-peroxidase (PAP) method using diaminobenzidineH2O2 development (Sternberger 1979
), and subsequently underwent triple immunofluorescence staining for islet hormones as above. Because the Nkx 6.1 and Pdx-1 stains were nuclear and islet hormone stains were cytoplasmic, no interference between immunofluorescence and PAP staining occurred. Sections used for PAP staining were first incubated in methanolH2O2 to quench endogenous peroxidase activity, exposed to normal goat serum, and PAP-stained followed by detection of peroxidase activity by diaminobenzidineH2O2.
Controls included conventional staining controls (Larsson 1988
) as well as absorptions of the antisera with recombinant human insulin and monocomponent porcine glucagon (Novo-Nordisk), synthetic somatostatin-14, synthetic rat pancreatic polypeptide (Peninsula Laboratories; Merseyside, UK), and with the recombinant Nkx 6.1 and Pdx-1 proteins cleaved from the GST fusion protein. Our previous studies have established that the HPP antiserum does not crossreact with peptide YY and neuropeptide Y (Jackerott et al. 1996
).
All staining and absorption controls were negative at all stages studied. Stainings with the Nkx 6.1 antiserum were eliminated by absorption against recombinant Nkx 6.1 but not with recombinant Pdx-1, whereas the reverse was true for the Pdx-1 antiserum. As a further control, double stainings for glucagon and PP employed poly-L-lysine (Mr 3600; Sigma, St Louis, MO) preabsorption of the primary antibodies (Scopsi et al. 1986
; cf. Larsson 1988
).
 |
Results |
|---|
Nkx 6.1 and Pdx-1 Immunoreactivities Are Present in Most Developing Early Pancreatic Anlage Cells but Show Different Distributions in the Duodenum
At the earliest fetal stage studied (22 somites, approximately E11.0) Pdx-1- and Nkx 6.1-immunoreactive nuclei were detected in epithelial cells of the dorsal (Figure 1AD) and ventral pancreatic buds. The nuclear staining for Pdx-1 was more intense than that for Nkx 6.1. At this stage, few and weakly stained glucagon-immunoreactive cells were observed in the dorsal but not in the ventral bud. The nuclei of the early glucagon cells did not stain for either Pdx-1 or Nkx 6.1, whereas most of the other epithelial cells of the dorsal and ventral buds contained Pdx-1- and Nkx 6.1-positive nuclei. By the 30-somite stage (approximately E11.5) the first insulin-immunoreactive cells were observed. All of the early insulin cells were also glucagon-positive. Only a few of these cells contained weakly Pdx-1- and Nkx 6.1-immunoreactive nuclei. Similarly, at this stage, only a few cells staining for glucagon (but not insulin) possessed weakly Pdx-1- and Nkx 6.1-positive nuclei. With both types of cells the frequency of nuclei staining for Pdx-1 approximated 10%, whereas the frequency of nuclei staining for Nkx 6.1 was somewhat lower. However, because at early stages of development the staining for Nkx 6.1 was weaker than that for Pdx-1, this difference may be more apparent than real. At all ages studied (E13.516.5 and P54) the duodenal epithelial cells contained Pdx-1-positive nuclei, whereas Nkx 6.1 was absent.

View larger version (99K):
[in this window]
[in a new window]
|
Figure 1.
Sections through the dorsal pancreatic bud of a 22-somite rat embryo (E11.0) (AD) and the splenic pancreas of a 15.5-day-old embryo (E15.5) (EL). (A, B) section double stained for Nkx 6.1 (red immunofluorescence, A and B) and glucagon (blue immunofluorescence, A) and was photographed by double (A) and single exposure (B). No insulin staining was observed at this stage of development. Note the absence of nuclear staining for Nkx 6.1 in the glucagon cell (arrow). An adjacent section (C,D) was double stained for Pdx-1 (red immunofluorescence, C and D) and glucagon (blue immunofluorescence, C). Note the similar distribution of Pdx-1 and Nkx 6.1. (EH) An E15.5 pancreas triple stained for Nkx 6.1 (red immunofluorescence, F), glucagon (blue immunofluorescence, H) and insulin (green immunofluorescence, G), and photographed by single red (F), green (G), blue (H), and triple exposure (E). Arrows indicate glucagon-negative insulin cells with strong nuclear staining for Nkx 6.1. Also note that the vast majority of the glucagon-positive cells, including those positive for both insulin and glucagon, are devoid of nuclear staining for Nkx 6.1. (IL) Nuclear staining for Pdx-1 shows a similar pattern of distribution at this stage of development in a neighbouring section triple stained for Pdx-1 (red immunofluorescence, J), glucagon (blue immunofluorescence, L), and insulin (green immunofluorescence, K). Arrows in IK indicate glucagon-negative insulin cells with strongly Pdx-1 immunopositive nuclei. Bar = 30 µm.
|
|
Insulin Cells That Do Not Co-express Glucagon Are Characterized by Intense Nuclear Staining for Pdx-1 and Nkx 6.1
During E11.513.5, progressively more glucagon- and insulin-positive cells appeared. These cells were arranged in clusters of cells immunopositive for both insulin and glucagon or for glucagon only. By E13.5, the first insulin-positive cells that did not also stain for glucagonere observed. Such glucagon-negative insulin cells almost invariably displayed intense nuclear staining for Pdx-1 and Nkx 6.1. These cells were few up to E15.5 (Figure 1EL). Between E15.5 and about E18.5, some major changes in the number and organization of the different cell types were observed (Figure 1EL and Figure 2AC). First, the number of single-positive insulin cells possessing Pdx-1- and Nkx 6.1-immunoreactive nuclei increased dramatically and, concomitantly, the number of cells immunopositive for both glucagon and insulin decreased. Second, the frequency of the (weakly) Pdx-1- and Nkx 6.1-positive glucagon cells decreased to the levels observed in adults (<1%). Third, the nuclear staining for Pdx-1 and Nkx 6.1 in the hormone-negative epithelial cells decreased in intensity, and by E18.5 Pdx-1- and Nkx 6.1-positive nuclei were mainly observed in duct epithelium and in insulin cells (Figure 2AC). Finally, at E15.5 and E16.5 the majority of the glucagon-negative and Pdx-1- and Nkx 6.1-positive insulin cells appeared as single cells, closely associated with the hormone-negative and Pdx-1- and Nkx 6.1-positive epithelial cells, whereas the insulin and glucagon double-positive cells were found mainly within clusters of glucagon cells (Figure 1EL). By E18.5, insulinglucagon double-positive cells were rare, and the frequency of insulin cells now exceeded the frequency of glucagon cells. These insulin cells almost invariably displayed strongly Pdx-1- and Nkx 6.1-immunopositive nuclei and usually occurred in association with Pdx-1- and Nkx 6.1-positive epithelial duct cells (Figure 2AC). At this stage of development, the glucagon clusters assumed an elongated form, as if they were gradually beginning to form a mantle around the insulin cells. Formation of true islet-like structures could be observed during the following 23 days. In the adult pancreas, Pdx-1 and Nkx 6.1 immunoreactivities were restricted to islet cells (Figure 2D). In addition, extremely rare hormone-negative epithelial cells with Nkx 6.1- or Pdx-1-positive nuclei were occasionally detected in the vicinity of the islets, among exocrine cells, or in ducts.

View larger version (107K):
[in this window]
[in a new window]
|
Figure 2.
Double (A) and single green (B) and red (C) exposures of a section through the pancreas of an 18.5-day-old rat embryo immunostained for Nkx 6.1 (red immunofluorescence) and insulin (green immunofluorescence). The insulin cells are Nkx 6.1-positive and closely associated with Nkx 6.1-immunoreactive duct cells surrounding an empty lumen. Bar = 20 µm. (D) Confocal image of adult rat pancreas (splenic) triple stained for Nkx 6.1 (red), glucagon (blue), and insulin (green). The Nkx 6.1 staining is restricted to the insulin cells. Bar = 10 µm. (EG) Section through the duodenal pancreas of a 5-day-old rat triple stained for PP (red immunofluorescence), glucagon (blue immunofluorescence) and insulin (green immunofluorescence). E and F are single exposures and G is a triple exposure. The majority of the PP-positive cells are positive for glucagon. Bar = 20 µm.
|
|
Quantitation of Insulin, Pdx-1, Nkx 6.1, and Gtx mRNA Expression During Pancreatic Development
Pancreatic specimens from E13.5E17.5 were analyzed by multiplex RT-PCR. At the earliest stage studied (E13.5) and during the following 2 days of development, low levels of insulin gene expression were detected (Figure 3A). From E15.5 to E17.5, the levels of insulin mRNA increased about 100-fold (inset in Figure 3A). Subsequently, from E17.5 to E19.5, no major changes in insulin gene expression were observed (Figure 3A). Two days after birth (P2), the levels of insulin mRNA were about 10 times the levels observed at E19.5 (Figure 3A). By E13.5, low levels of Nkx 6.1, Pdx-1, and Gtx mRNAs were detected (Figure 3B and Figure 3C). By E14.5 the levels of Pdx-1 and Nkx 6.1 mRNAs increased and then remained relatively constant until E16.5. During this period, the levels of Pdx-1 and Nkx 6.1 mRNAs were four to five times higher than those of Gtx (Figure 3C). By E17.5 the levels of all three mRNAs fell and then rose again by E18.5. Postnatally, significant expression of Nkx 6.1 and Pdx-1 was present in the pancreas but fell to very low levels in adult pancreas. Insulin expression followed a similar pattern, reflecting the development of the exocrine portion of the pancreas. In isolated islets from new-born rats, high levels of Pdx-1 and Nkx 6.1 mRNAs were detected, whereas Gtx mRNA was undetactable.

View larger version (27K):
[in this window]
[in a new window]
|
Figure 3.
Multiplex RT-PCR analysis of gene expression during rat pancreatic development. (A) Quantitated data of insulin I and II expression. Insulin was co-amplified with tubulin (16 cycles) and data are given as ratios to this gene (n = 3). A blow-up of E13.5E17.5 is inserted in upper left area. (B) Co-amplification of Nkx 6.1 (289 BP), Pdx-1 (224 BP), and GTX (160 BP) using TBP (TATA-binding protein, 190 BP) as internal standard (25 cycles, all samples in exponential phase). Adult brain cDNA was included as positive control for GTX. Some degradation of the pancreatic RNA is observed from E19.5 onwards. (C) Quantitated data from triplicate assays as in B. GTX, Nkx 6.1, and Pdx-1 levels are given as ratios relative to TBP.
|
|
Developing and Mature Somatostatin Cells Are Devoid of Nkx 6.1 but Show Labeling for Pdx-1
By E16.5, somatostatin cells were first observed. During E16.517.5, only a few somatostatin cells occurred and some of these cells also stored insulin (data not shown). No cells co-storing somatostatin and glucagon were detected. Pdx-1-positive nuclei were detected in some but not all somatostatin cells irrespective of whether or not they also stored insulin. No somatostatin cells containing Nkx 6.1-positive nuclei were found. By E18.5, somatostatin cells became much more numerous. At this stage, very few cells staining for both somatostatin and insulin were found. Almost all (>90%) somatostatin cells had Pdx-1-positive nuclei, whereas none had Nkx 6.1-positive nuclei. In addition, during the ensuing development no Nkx 6.1-positive somatostatin cells were seen. After E18.5, the frequency of Pdx-1-positive somatostatin cells decreased to the 1020% seen in adult pancreas. No cells staining for both insulin and somatostatin were detected after E19.5.
Developing PP Cells Frequently Contain Glucagon and Are Occasionally Positive for Pdx-1 but Rarely Positive for Nkx 6.1
By E20.5, the first PP-immunoreactive cells were detected. Occasional cells immunopositive for both insulin and PP were seen, but after P3 no such cells could be detected. In contrast, many cells were immunopositive for both glucagon and PP (Figure 2EG). During E21.5P5, counts revealed that the proportion of such double-positive cells increased from about 2030% of all PP cells (E21.5P2) to 6075% at P3P5. Subsequently, the frequency of double-positive cells decreased again. In adult pancreatic islets, variable numbers of cells immunopositive for both glucagon and PP (1738% of PP-positive cells) were seen in the duodenal portion and tail of the pancreas. At all stages of development, weak nuclear Pdx-1 staining could be detected in a few (<5%) PP cells. Most of these Pdx-1-positive PP cells were negative for both glucagon and insulin. Only extremely rare (<1%) PP cells contained weakly Nkx 6.1-positive nuclei. These were seen only in the perinatal period and not in adults. About half of the Nkx 6.1-positive PP cells were also immunoreactive for glucagon, but none stained for insulin.
 |
Discussion |
|---|
This is the first report on the developmental expression of Nkx 6.1 in the pancreas. This homeodomain gene product was previously found to be present in the insulin cells of the adult pancreas and in RNA extracted from antropyloric mucosa of the stomach (Jensen et al. 1996
). It shows sequence similarity to the glialtestis homeobox (Gtx) gene product (Komura et al. 1993
), raising some concern that crossreactivity may occur. However, analyses of the expression pattern of Nkx 6.1 in developing and adult rat pancreas correlate closely to the immunocytochemical findings, whereas no such correlation is seen with Gtx. Moreover, we have recently found that Nkx 6.1-immunoreactive nuclei are absent from the antropyloric mucosa of mice deficient in Pdx-1, whereas they are readily detected in wild-type control mice. Importantly, comparable levels of Gtx gene expression were discovered in both Pdx-1-deficient and control mice (Oster et al. 1998
). These data provide strong evidence that our antiserum specifically detects Nkx 6.1 and does not crossreact with Gtx. Moreover, these data show that Pdx-1 is needed for Nkx 6.1 gene expression.
Against this background, it is very interesting to note the great parallels in Nkx 6.1 and Pdx-1 gene expression in the developing pancreas. During early development the majority of the parenchymal cells were immunopositive for both Pdx-1 and Nkx 6.1, and later during development both immunoreactivities became virtually restricted to islet cells. Pdx-1 showed a wider expression pattern than Nkx 6.1 and was also detected in the duodenal epithelium and in many non-ß-cells of the developing and adult pancreas. This pattern agrees with the hypothesis that Pdx-1, together with other factors, may activate Nkx 6.1 gene expression (cf. Oster et al. 1998
). Pdx-1-deficient mice do not develop a pancreas (Jonsson et al. 1994
; Offield et al. 1996
), and it is possible that Nkx 6.1 may also be important to pancreatic development, perhaps by mediating some of the effects of Pdx-1.
We found the majority of the earliest glucagon- and insulin-immunopositive cells to be devoid of Nkx 6.1 and Pdx-1 staining. This contrasts to the report by Guz et al. 1995
that, at all stages of mouse pancreatic development, the majority of insulin cells were Pdx-1-positive, but agrees well with the data from Ahlgren et al. 1996
that the early insulin and glucagon cells also develop in Pdx-1 deficient mice.
All the insulin cells that we observed during early development co-stored glucagon. The majority of these insulinglucagon double-positive cells were devoid of nuclear staining for Pdx-1 and Nkx 6.1 and occurred intermingled with cells positive for glucagon only. According to Pictet and Rutter 1972
, cells containing ß-granules are not found during this period (the "protodifferentiated state"). However, during the following days of development (the "secondary transition state"), cells with ß-granules appear and increase in number. During the same period we observed a major increase in insulin mRNA and in the number of insulin-positive cells. In contrast to the early insulin cells, these "late" insulin cells were devoid of glucagon immunoreactivity, displayed strongly Pdx-1- and Nkx 6.1-immunopositive nuclei, and appeared as single cells or as small clusters closely associated with the Pdx-1- and Nkx 6.1-positive and hormone-negative epithelial cells. Coinciding with the burst in the number of insulin cells, the staining intensity for Pdx-1 and Nkx 6.1 in nuclei of hormone-negative epithelial cells declined.
It has been suggested that the insulinglucagon double-positive cells of the developing pancreas represent precursors of mature ß-cells (Alpert et al. 1988
; Hashimoto et al. 1988
). Recently, this theory was challenged by Pang et al. 1994
, who reported that the ß-cell-associated protein glucose transporter Type 2 (Glut2) protein showed a developmental distribution very similar to the distribution of Pdx-1 and Nkx 6.1 described by us. Pang et al. 1994
suggested that the early glucagon-positive insulin cells (Glut2-negative) and the later appearing single-positive insulin cells (Glut2-positive) represented two different populations of insulin cells, and that the latter were derived from Glut2-immunoreactive, hormone-negative epithelial cells. Similar patterns of distribution during development have also been described for the high-affinity NGF receptor Trk-A (Kanaka-Gantenbein et al. 1995
) and fetal antigen 1 (Tornehave et al. 1996
). Induction of Glut2 expression and an increase in the number of insulin cells associated with duct cells have been described after duct ligation (Hultquist et al. 1979
; Wang et al. 1995
). In addition, differentiation of islet cells from adult pancreatic duct epithelium in the presence of fetal mesenchyme has been demonstrated (Dudek et al. 1991
). These reports are in accordance with our observations of the scattered appearance of single Pdx-1- and Nkx 6.1-immunoreactive insulin cells among the Pdx-1- and Nkx 6.1-positive hormone negative epithelial cells that we observed during E15.5E17.5. Subsequently, these cells were found in close association with Pdx-1- and Nkx 6.1-immunoreactive duct cells (cf Figure 2AC). Previous quantitative studies of the developing rat pancreas indicate that preexisting islet cells could account for no more than 20% of the large increase in the number of insulin cells (>200%) observed during E20E22 (Hellerstrom and Swenne 1985
). Taken together, the above observations indicate that the majority of ß-cells arise from hormone-negative precursors, such as Pdx-1-and Nkx 6.1-positive duct cells. However, the insulinglucagon double-positive cells may contribute to ß-cell formation as well, because these cells do indeed proliferate (Jackerott et al. 1996
). Alternatively, the insulin and glucagon co-storing cells may represent a fraction of immature glucagon cells with aberrant insulin expression, like the gastrin-expressing cells observed during pancreatic development (Larsson et al. 1976a
; Gittes et al. 1993
).
In contrast to data obtained in the developing mouse pancreas (Guz et al. 1995
), we found many glucagon-immunoreactive PP cells in the developing pancreas of the rat, especially during the perinatal period. A similar pattern has been observed in human fetal pancreas (Larsson and Hougaard 1994
), in the AN glucagonoma islet cell line, and in islets from newborn rats (Jensen et al. 1996
). Therefore, if islet cells develop through multihormonal precursors, these PPglucagon double-positive cells may represent precursors of mature PP cells. In contrast to Alpert et al. 1988
, but in agreement with Upchurch et al. 1994
, our study revealed only rare insulinsomatostatin double-positive cells during development. This discrepancy may be explained by the thick sections used by Alpert et al. 1988
(cf. Upchurch et al. 1994
). At E18.5, when a major increase in the number of somato-statin cells was observed, the majority of these cells (>90%) displayed Pdx-1-positive nuclei. These observations may indicate that somatostatin cells are derived from Pdx-1-immunoreactive precursor cells. Pdx-1 was originally cloned from somatostatin-producing islet cell lines and was characterized as a somatostatin transactivating factor (Leonard et al. 1993
; Miller et al. 1994
). However, Pdx-1 does not appear to be obligatory for somatostatin gene transcription, because the majority (>80%) of adult somatostatin cells are Pdx-1-negative and because Pdx-1-deficient mice show normal gastric somatostatin cell numbers (Larsson et al. 1996
).
Pdx-1 has also been characterized as an insulin gene transcription factor (Ohlsson et al. 1993
; Peers et al. 1994
; Petersen et al. 1994
; Serup et al. 1995
). However, the absence of Pdx-1- and Nkx 6.1-immunoreactive nuclei in early insulin cells indicates that neither Pdx-1 nor Nkx 6.1 is obligatory for transcription of the insulin gene. In agreement with this, the presence of early insulin-positive cells in Pdx-1-deficient mice (Ahlgren et al. 1996
) confirms that Pdx-1 is not necessary for insulin gene transcription. Moreover, the observation that the insulin gene, but not the Nkx 6.1 gene, is activated when Pdx-1 is transfected and expressed in glucagonoma cell lines (Serup et al. 1996
; Madsen et al. 1997
) confirms that Nkx 6.1 is not indispensible for insulin gene transcription. Pdx-1 and Nkx 6.1 may, however, be important for regulating insulin gene transcription and other ß-cell-specific functions.
 |
Acknowledgments |
|---|
Supported by grants from the Danish National Research Fund (Center for Gene Regulation and Plasticity in the Neuroendocrine Network), the Danish MRC, and the Danish Biotechnology Program (Research Center for Medical Biotechnology).
Received for publication August 18, 1997; accepted January 7, 1998.
 |
Literature Cited |
|---|
Ahlgren U, Jonsson J, Edlund H (1996) The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX-1-deficient mice. Development 122:1409-1416[Abstract]
Alpert S, Hanahan D, Teitelman G (1988) Hybrid insulin genes reveal a developmental lineage for pancreatic endocrine cells and imply a relationship with neurons. Cell 53:295-308[Medline]
de Krijger RR, Aanstoot JH, Kranenburg F, Reinhard M, Visser WJ, Bruining GJ (1992) The midgestational human fetal pancreas contains cells coexpressing islet hormones. Dev Biol 153:368-375[Medline]
Dudek RW, Lawrence IEJR, Hill RS, Johnson RC (1991) Induction of islet cytodifferentiation by fetal mesenchyme in adult pancreatic ductal epithelium. Diabetes 40:1041-1048[Abstract]
Gittes GK, Rutter WJ, Debas HT (1993) Initiation of gastrin expression during the development of the mouse pancreas. Am J Surg 165:23-26[Medline]
Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CVE, Teitelman G (1995) Expression of murine STF-1, a putative insulin gene transcription factor, in ß cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11-18[Abstract]
Hashimoto T, Kawano H, Daikoku S, Shima K, Taniguchi H, Baba S (1988) Transient coappearance of glucagon and insulin in the progenitor cells of the rat pancreatic islets. Anat Embryol 178:489-497[Medline]
Hellerström C, Swenne I (1985) Growth pattern of pancreatic islets in animals. In Volk BW, Arquilla ER, eds. The Diabetic Pancreas. 2nd Ed. New York, Plenum Press, 53-79
Herrera P-L, Huarte J, Zufferey R, Nichols A, Mermillod B, Philippe J, Muniesa P, Sanvito F, Orci L, Vassalli J-D (1994) Ablation of islet endocrine cells by targeted expression of hormone-promoter-driven toxigenes. Proc Natl Acad Sci USA 91:12999-13003[Abstract/Free Full Text]
Hultquist GT, Karlsson U, Hallner AC (1979) The regenerative capacity of the pancreas in duct-ligated rats. Exp Pathol 17:44-52
Jackerott M, Øster A, Larsson L-I (1996) PYY in developing murine islet cells: comparisons to development of islet hormones, NPY, and BrdU incorporation. J Histochem Cytochem 44:809-817[Abstract]
Jensen J, Serup P, Karlsen C, Nielsen TF, Madsen OD (1996) mRNA profiling of rat islet tumors reveals Nkx 6.1 as a ß-cell-specific homeodomain transcription factor. J Biol Chem 271:18749-18758[Abstract/Free Full Text]
Jonsson J, Carlsson L, Edlund T, Edlund H (1994) Insulin promoter-factor 1 is required for pancreas development in mice. Nature 371:606-609[Medline]
KanakaGantenbein C, Tazi A, Czernichow P, Scharfmann R (1995) In vivo presence of the high affinity nerve growth factor receptor Trk-A in the rat pancreas: differential localization during pancreatic development. Endocrinology 36:761-769
Komura I, Schalling M, Jahn L, Bodmer R, Jenkins NA, Copeland NG, Izumo S (1993) Gtx: a novel murine homeobox-containing gene, expressed specifically in glial cells of the brain and germ cells of testis, has a transcriptional repressor activity in vitro for a serum-inducible promoter. EMBO J 12:1387-1401[Medline]
Larsson L-I (1988) Immunocytochemistry: Theory and Practice. Boca Raton, FL, CRC Press
Larsson L-I, Holst J, Håkanson R, Sundler F (1975) Distribution and properties of glucagon immunoreactivity in the digestive tract of various mammals: an immunohistochemical and immunochemical study. Histochemistry 44:281-290[Medline]
Larsson L-I, Hougaard DM (1994) Coexpression of islet hormones and messenger RNAs in the human foetal pancreas. Endocrine 2:759-765
Larsson L-I, Madsen OD, Serup P, Jonsson J, Edlund H (1996) Pancreatic duodenal homeobox 1role in gastric endocrine patterning. Mech Dev 60:175-184[Medline]
Larsson L-I, Rehfeld JF, Sundler F, Hakanson R (1976a) Pancreatic gastrin in foetal and neonatal rats. Nature 262:609-610[Medline]
Larsson L-I, Sundler F, Håkanson R (1976b) Pancreatic polypeptidea postulated new hormone: identification of its cellular storage site by light and electron microscopic immunocytochemistry. Diabetologia 12:211-226[Medline]
Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR (1993) Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275-1283[Abstract]
Lukinius A, Ericsson JLE, Grimelius L, Korsgren O (1992) Ultrastructural studies of the ontogeny of fetal human and porcine endocrine pancreas, with special reference to colocalization of the four major islet hormones. Dev Biol 153:376-385[Medline]
Madsen OD, Jensen J, Petersen HV, Pedersen EE, Øster A, Andersen FG, Jørgensen MC, Jensen PB, Larsson L-I, Serup P (1997) Transcription factors contributing to the pancreatic ß-cell phenotype. Horm Metab Res 29:265-270[Medline]
Miller CP, McGehee RE, Jr, Habener JF (1994) IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145-1156[Medline]
Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BLM, Wright CVE (1996) PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983-995[Abstract]
Ohlsson H, Karlsson K, Edlund T (1993) IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251-4259[Medline]
Øster A, Jensen J, Edlund H, Larsson L-I (1998) Homeobox gene product Nkx 6.1 immunoreactivity in nuclei of endocrine cells of rat and mouse stomach. J Histochem Cytochem 46:717-721[Abstract/Free Full Text]
Pang K, Mukonoweshuro C, Wong GG (1994) Beta cells arise from glucose transporter type 2 (Glut2)-expressing epithelial cells of the developing rat pancreas. Proc Natl Acad Sci USA 91:9559-9563[Abstract/Free Full Text]
Peers B, Leonard J, Sharma S, Teitelman G, Montminy MR (1994) Insulin expression in pancreatic islet cells relies on cooperative interaction between helix-loop-helix factor E47 and the homeobox factor STF-1. Mol Endocrinol 8:1798-1806[Abstract]
Peshevaria M, Gamer L, Henderson E, Teitelman G, Wright CVE, Stein R (1994) XlHbox8, an endoderm-specific Xenopus homeodomain protein, is closely related to a mammalian insulin gene transcription factor. Mol Endocrinol 8:806-816[Abstract]
Petersen HV, Serup P, Leonard J, Michelsen BK, Madsen OD (1994) Transcriptional regulation of the human insulin gene is dependent on the homeodomain protein STF1/IPF1 acting through the CT boxes. Proc Natl Acad Sci USA 91:10465-10469[Abstract/Free Full Text]
Pictet R, Rutter WJ (1972) Development of the embryonic endocrine pancreas. In Steiner DF, Frenkel N, eds. Handbook of Physiology/Endocrinology. Vol 7. Washington, DC, American Physiological Society, 25-66
Rudnick A, Ling TY, Odagiri H, Rutter WJ, German MS (1994) Pancreatic beta cells express a diverse set of homeobox genes. Proc Natl Acad Sci USA 91:12203-12207[Abstract/Free Full Text]
Scopsi L, Wang B-L, Larsson L-I (1986) Nonspecific immunocytochemical reactions with certain neurohormonal peptides and basic peptide sequences. J Histochem Cytochem 34:1469-1475[Abstract]
Serup P, Jensen J, Andersen FG, Jørgensen MC, Blume N, Holst JJ, Madsen OD (1996) Induction of insulin and islet amyloid polypeptide production in pancreatic islet glucagonoma cells by insulin promoter factor 1. Proc Natl Acad Sci USA 93:9015-9020[Abstract/Free Full Text]
Serup P, Petersen HV, Pedersen EE, Edlund H, Leonard J, Petersen JS, Larsson L-I, Madsen OD (1995) The homeodomain protein IPF-1/STF-1 is expressed in a subset of islet cells and promotes rat insulin 1 gene expression dependent on an intact E1 helix-loop-helix factor binding site. Biochem J 310:997-1003
Spooner BS, Walther BT, Rutter WJ (1970) The development of the dorsal and ventral mammalian pancreas in vivo and in vitro. J Cell Biol 47:235-246[Abstract/Free Full Text]
Stein S, Fritsch R, Lemaire L, Kessel M (1996) Checklist: vertebrate homeobox genes. Mech Dev 55:91-108[Medline]
Sternberger LA (1979) Immunocytochemistry. 2nd Ed. New York, John Wiley
Teitelman G, Alpert S, Polak JM, Martinez A, Hanahan D (1993) Precursor cells of mouse endocrine pancreas coexpress insulin, glucagon and the neuronal protein tyrosine hydroxylase and neuropeptide Y, but not pancreatic polypeptide. Development 118:1031-1039[Abstract]
Tornehave D, Jensen CH, Teisner B, Larsson L-I (1996) FA1 immunoreactivity in endocrine tumors and during development of the human fetal pancreas: negative correlation with glucagon expression. Histochem Cell Biol 106:535-542[Medline]
Upchurch BR, Aponte GW, Leiter AB (1994) Expression of peptide YY in all four islet cell types in the developing mouse pancreas suggests a common peptide YY-producing progenitor. Development 120:245-252[Abstract]
Wang RN, Klöppel G, Bouwens L (1995) Duct- to islet-cell differentiation and islet growth in the pancreas of duct-ligated rats. Diabetologia 38:1405-1411[Medline]