Tord Berggårda,
Tim D. Ouryb,
Ida B. Thøgersenb,
Bo Åkerströma, and
Jan J. Enghildb
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Summary |
|---|
|
|
|---|
In this study we demonstrate that, in addition to blood,
1-microglobulin (
1m) is present in most tissues, including liver, heart, eye, kidney, lung, pancreas, and skeletal muscle. Western blotting of perfused and homogenized rat tissue supernatants revealed
1m in its free, monomeric form and in high molecular weight forms, corresponding to the complexes fibronectin
1m and
1-inhibitor-3
1m, which have previously been identified in plasma. The liver also contained a series of
1m isoforms with apparent molecular masses between 40 and 50 kD. These bands did not react with anti-inter-
-inhibitor antibodies, indicating that they do not represent the
1m-bikunin precursor protein. Similarly, the heart contained a 45-kD
1m band and the kidney a 50-kD
1m band. None of these
1m isoforms was present in plasma. Immunohistochemical analysis of human tissue demonstrated granular intracellular labeling of
1m in hepatocytes and in the proximal epithelial cells of the kidney. In addition,
1m immunoreactivity was detected in the interstitial connective tissue of heart and lung and in the adventitia of blood vessels as well as on cell surfaces of cardiocytes.
1m mRNA was found in the liver and pancreas by polymerase chain reaction, suggesting that the protein found in other tissues is transported via the bloodstream from the production sites in liver and pancreas. The results of this study indicate that in addition to its role in plasma,
1m may have important functions in the interstitium of several tissues. (J Histochem Cytochem 46:887893, 1998)
Key Words:
1-microglobulin (
1m), lipocalin, immunohistochemistry, tissue distribution
| Introduction |
|---|
|
|
|---|
1-Microglobulin (
1m) is a yellow-brown 26-kD glycoprotein which was originally isolated from the urine of patients with renal defects (![]()
![]()
1m is a member of the lipocalin superfamily, which now includes approximately 25 members (![]()
1-acid glycoprotein (orosomucoid), and prostaglandin D-synthase are other members of this family and, like
1m, are predominantly extracellular proteins. A majority of the lipocalins bind and transport specific small hydrophobic substances, such as retinoids and steroids, in a hydrophobic pocket. This pocket is formed by eight antiparallel ß-strands folded into a ß-barrel, lined on the inside by hydrophobic residues that specify the ligand specificity of each lipocalin (![]()
![]()
1m and the other lipocalins is presently not known because the binding specificity of
1m has not been identified.
1m has a strong tendency to form complexes with other proteins. In human and rat, approximately half of the plasma
1m exists as high molecular weight forms, which are too large to escape from the circulation via glomerular filtration. Curiously, the
1m complexes that have been found thus far in human plasma are not found in rat plasma, and vice versa.
1m has been shown to be complexed with IgA, prothrombin, and albumin in humans (Tejler et al. 1976; ![]()
![]()
2-macroglobulin homologue
1-inhibitor-3 in rats (![]()
![]()
1m complexes are unknown, but the
-inhibitor-3
1m complex was shown to be rapidly cleared from the circulation (![]()
The gene for
1m has been isolated and characterized (![]()
![]()
1m and bikunin (![]()
-inhibitor, pre-
-inhibitor, and heavy chain 2bikunin (![]()
![]()
![]()
-inhibitor has been shown to be an important component for the formation of the extracellular matrix (![]()
![]()
When synthesized, a precursor protein is translated in which
1m and bikunin are connected by a short peptide. The precursor is cleaved into the two mature proteins before secretion (![]()
![]()
![]()
1m and bikunin is conserved in all species examined to date (from fish to human) (![]()
![]()
1m and bikunin in plasma.
1m has been extensively studied in blood, but although different immunoregulatory properties have been reported for
1m (for reviews see ![]()
![]()
1m is generally considered to be a plasma protein, but the result reported in this study reveals that
1m is present in the extracellular matrix of many tissues. Moreover,
1m is not generally synthesized in the tissues but mainly in the liver, and is probably transported to the tissues across the endothelial cell membrane by an unknown mechanism. In addition, both high and low molecular weight forms of
1m are widely distributed in the matrix of tissues, suggesting a possible function in these interstitial tissue domains.
| Materials and Methods |
|---|
|
|
|---|
Materials
The general serine-proteinase inhibitor 3,4-dichloroisocoumarin (DCI) and the general cysteine-proteinase inhibitor N-[[[N[-[(-3-trans-carboxyl-oxiran-2-yl)-carbonyl]L-leucyl] amino]-butyl]-guanidine (E-64) were from Boehringer-Mannheim (Indianapolis, IN). Goat anti-rabbit IgGalkaline phosphatase-conjugated antiserum, 1,10-phenanthroline bromochloroindolyl phosphate, and nitroblue tetrazolium were purchased from Sigma (St Louis, MO). Rabbit antisera against human
1m were purchased from Accurate Chemical and Scientific (Westbury, NY). Rat plasma was obtained from Pel-Freeze Biologicals, (Rogers, AR). The rabbit antiserum against rat
1m was prepared as described previously (![]()
1m was purified from the urine of patients with tubular proteinuria as described (![]()
1-inhibitor-3 was purified as reported earlier (![]()
SDS-polyacrylamide Gel Electrophoresis
Aliquots of the supernatant from each of the homogenized tissue samples were subjected to SDS-PAGE under nonreducing conditions. This was performed in 515% linear gradient gels using the glycine2-amino-2-methyl-1,3-propanediol-HCl system described by ![]()
1-inhibitor-3 (180 kD) mixed with Bio-Rad (Hercules, CA) low molecular weight mass standard, visualized by staining with Coomassie Brilliant Blue.
Western Blot Analysis
Proteins were separated by SDS-PAGE and transferred to polyvinylidene diflouride membrane (PVDF) as described by ![]()
1m antiserum (1:2000 dilution). After 1 hr the membrane was washed twice in TSN buffer and twice in 10 mM Tris-HCl, 10 mM NaCl, pH 7.5 (TS buffer) for 5 min each. Then 20 ml of TSN buffer containing 10 µl anti-rabbit IgGalkaline phosphatase conjugate (1:2000 dilution) was allowed to react for 30 min before the membrane was washed as above. The substrates bromochloroindolyl phosphate and nitroblue tetrazolium were added and color was allowed to develop in the dark for up to 30 min. The reaction was stopped with 5 mM EDTA in TS buffer.
Perfusion of Rat Tissues
SpragueDawley rats were anesthetized by IP injection with pentobarbital. After sedation they were opened and one lung was removed. A blood sample was taken from the left ventricle of the heart, and the animal perfused via the same needle, using 500 ml of 0.9% normal saline. Perfusion of the lungs was performed by infusion of 100 ml of 0.9% saline through the right ventricle of the heart after cutting the abdominal aorta. The organs were removed, weighed, and homogenized in a high-speed homogenizer (Cole-Parmer Instruments; Niles, IL) in 100 mM NaCl, 50 mM (N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES), 100 mM 3,4-dichloroisocoumarin (DCI), 500 µM 1,10-phenanthroline, and 50 µM N-[[[N[-[(-3-trans-carboxyl-oxiran-2-yl)-carbonyl]L-leucyl]amino]-butyl]-guanidine (E-64) (10 ml/g). The homogenates were then centrifuged at 2500 rpm for 15 min and the supernatant was collected.
Immunohistochemistry
Human tissues were fixed in 10% formalin followed by routine processing and paraffin embedding. Sections were then labeled for antigen using an indirect immunoperoxidase method (![]()
![]()
As a control, one serial section on each slide was incubated with preimmune rabbit serum or with anti-
1m antibodies absorbed by immunosorbent affinity chromatography. The latter was done by immobilizing 1 mg of purified
1m to 1 ml CNBr-activated Sepharose according to the manufacturer's instructions (Sigma). The affinity gel was then incubated for 24 hr with 1 ml of primary antibodies at two times the concentration used for immunolabeling. The supernatant was then used for immunohistochemistry.
Reverse Transcriptase PCR
The presence of mRNA in the tissue was examined by extracting RNA essentially as described previously (![]()
1mbikunin RNA is amplified with specific primers using a thermocycler (PerkinElmer Cetus GeneAmp PCR system 9600; Norwalk, CT) and appropriate reagents (Gene Amp, EZ rTth RNA PCR kit). The
1m-specific primers were 5'tgctgggagagggcgctaca3' (forward) and 5'gcccatgcagccgccgtact 3' (reverse). The expected 593-BP product was generated by first incubating at 30 min at 60C and 1 min at 94C followed by 40 cycles at 94C for 15 sec and 70C at 30 sec. As a positive control, RT-PCR was performed on all tissues using primers specific for glyceraldehyde 3-phosphate dehydrogenase. The product was generated by first incubating at 30 min at 60C and 100 sec at 94C followed by 40 cycles at 94C for 15 sec and 69C at 30 sec. Presence of the predicted 336-BP product ensured that negative results for
1mbikunin RNA were not due to RNA degradation in the tissue.
| Results |
|---|
|
|
|---|
Identification of
1m in Perfused Rat Tissue
Perfused rat tissues were homogenized and insoluble debris was removed by centrifugation. Aliquots of the supernatants were analyzed by SDS-PAGE, followed by Western blotting using anti-rat
1m antiserum. The distributions of the different
1m species in rat plasma and in the perfused rat tissues were compared (Figure 1A). In plasma, several
1m-immunoreactive bands with apparent molecular masses of 28, 43, 75, 110, 180210, and 240 kD were evident. These bands specifically reacted with rat
1m antisera (Figure 1B). The 28-kD band is free uncomplexed rat plasma
1m and the 240-kD and 180210 kD bands represent the fibronectin
1m and
1-inhibitor-3
1m complexes, respectively (![]()
![]()
1m and
-inhibitor-3
1m. The 180210 kD
-inhibitor-3
1m complex was absent from the liver, and the 240-kD fibronectin
1m complex was absent from the lung and pancreas. As discussed previously, the 110- and 75-kD bands are most likely degradation products of the two complexes (![]()
![]()
|
Some tissues contained forms of
1m that were not found in plasma. The liver contained five
1m isoforms with molecular masses between 40 and 50 kD. The 50-kD
1m isoform was also present in the kidney, and the heart contained a slightly smaller 45-kD isoform. The pancreas and the eye contained more free
1m relative to the larger complexes than the other tissues. The 18-kD band observed in the eye homogenate represented a nonspecific reaction because it was present even when the primary antiserum was omitted (not illustrated). The brain contained only the 110-kD band. Western blotting of the same samples using an antibody against a control plasma protein yielded the expected band in plasma, whereas other tissue samples were negative (not shown). This shows that the
1m bands in the tissues did not originate from plasma contamination.
Immunochemical Localization of
1m Proteins in Human Tissues
To investigate the tissue distribution of the
1m proteins, we obtained paraffin-embedded sections of human tissue, including heart, liver, lung, and kidney. These tissue sections were labeled with antisera to
1m and detected using a biotinstreptavidinhorseradish peroxidase technique. The studies revealed a granular, cytoplasmic labeling for
1m in the liver (Figure 2A). This is expected because hepatocytes have been shown to be the primary site of
1m synthesis (![]()
![]()
![]()
![]()
1m was present in the proximal tubules of the kidney (Figure 2G). This result is also expected because
1m is known to be filtered by the glomeruli and reabsorbed in the tubules. Immunochemical staining of the heart and lung also demonstrated positive labeling for
1m, supporting the results of Western blot analysis of these tissues (Figure 1). Specifically, labeling for
1m was found in the extracellular matrix of blood vessels in the heart (Figure 2B), lung (Figure 2F), liver, and kidney (not illustrated). Furthermore,
1m was also present on the cell surface of cardiocytes in the heart (Figure 2C) and within the matrix of alveolar septa and airways in the lung (Figure 2E and Figure 2F). No labeling was observed when nonimmune serum was substituted for the primary antibody or when antibodies were absorbed with purified
1m (Figure 2D and Figure 2H). These results indicate that the labeling was specific for
1m.
|
Reverse Transcriptase PCR
The results described above show that
1m is distributed throughout the body. To determine if the protein was made locally, we examined tissue samples for the presence of
1m mRNA. Appropriate primers were designed as described above and reverse transcriptase PCR was performed on mRNA extracted from the following human tissues: liver, kidney, lung, heart, spleen, muscle, thyroid, pancreas, and adrenal gland. Figure 3 shows that only the liver and the pancreas produced
1m RNA. The 0.6-KB PCR band was much weaker in pancreas, suggesting a lower rate of gene transcription and protein synthesis in pancreas than in liver. All tissues contained mRNA for glyceraldehyde 3-phosphate dehydrogenase, indicating that the lack of
1m mRNA was not due to RNA degradation. These results indicate that
1m present in the other tissues is not locally synthesized but is produced mainly in the liver, secreted into the blood, and transported to the tissues from the plasma by an unknown mechanism.
|
| Discussion |
|---|
|
|
|---|
Previous studies have demonstrated
1m immunoreactivity in skin, colon, testis, and ovary (![]()
![]()
![]()
1m is also present in many other tissues, including liver, heart, eye, kidney, brain, lung, pancreas, and skeletal muscle. An intense granular intracellular labeling was observed in hepatocytes, consistent with production and secretion by these cells. Intracellular
1m labeling was also observed in the proximal tubule cells of the kidney. This was expected because the small size of
1m promotes uptake, reabsorbance and degradation by the kidneys (![]()
![]()
![]()
![]()
![]()
![]()
1m-containing tissues did not show any intracellular labeling but instead demonstrated widespread staining in the interstitial connective tissue matrix. For example, the matrix of blood vessels and the matrix of alveolar septa and airways in the lung were labeled by anti-
1m.
Most of the known plasma proteins, except the immunoglobulins, are synthesized by hepatocytes. In some cases, additional synthesis of plasma proteins takes place in other cell types (![]()
![]()
1m has been reported to be synthesized by the liver (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
1m. In the present study, done on human tissue,
1m mRNA was detected in the liver and, to a lesser extent, in the pancreas, suggesting that human
1m is mainly produced in the liver, but with a minor contribution from the pancreas. The presence of
1m in pancreas is presently being investigated by immunohistochemical and biochemical analyses (Lögdberg et al., manuscript in preparation). All other organs in which staining by anti-
1m was demonstrated lacked
1m mRNA. The
1m present in the interstitial connective tissue matrix of different organs is therefore most likely not synthesized locally but is transported to these compartments from blood. This is supported by the fact that although the
1mbikunin mRNA content is elevated during inflammation, the total plasma concentrations and urinary excretion of bikunin and
1m remain unchanged (![]()
1m is found in plasma both as a monomer and in complexes with other plasma proteins. These plasma complexes are mainly covalent and have previously been analyzed (![]()
![]()
![]()
![]()
1m complexes are not known. Many low molecular mass plasma proteins are rapidly eliminated from plasma by glomerular filtration. In some cases, the low molecular weight proteins are complex-bound to larger proteins in plasma, resulting in a slower elimination time (![]()
1m and other plasma proteins may be to prevent loss of
1m by filtration through the kidney glomeruli (![]()
1m, relative to free
1m in the tissues. In addition, the brain contained high molecular weight
1m, although plasma proteins are unable to cross the bloodbrain barrier. These findings suggest that the transport from the blood to the tissues is receptor-mediated.
The results reported here indicate that the biodistribution of
1m is not restricted to blood. In fact,
1m is widely distributed in the interstitial matrices and appears to form tissue-specific complexes with other proteins that are not found in plasma. Therefore,
1m could be regarded as a matrix protein in addition to its previous categorization as a plasma protein. Several possible functions for tissue
1m can be envisioned. As speculated previously (![]()
![]()
![]()
1m, i. e., the inhibition of lymphocyte proliferation and granulocyte chemotaxis and migration, protect "bystander" interstitial tissue from the immune and inflammatory reactions. Furthermore,
1m is a member of the lipocalin superfamily. Most of the lipocalins are carriers of small hydrophobic prosthetic groups such as retinol, pheromones, odorants, bilirubin, and steroids (![]()
1m is a transporter of such small prosthetic groups from blood to tissues. This would be in agreement with
1m being synthesized mainly in the liver but found in most organs. Finally, the specific presence of
1m around blood vessels and in lung airways and alveolar septa resembles that of extracellular superoxide dismutase (EC-SOD), a scavenger of the superoxide anion (![]()
1m in these domains is possible, as an immunoprotective agent, as a potential scavenger of small toxic substances, or both.
| Acknowledgments |
|---|
Supported by grants from the Swedish Medical Research Council (project no. 7144), King Gustav Vs 80-year Foundation, the Medical Faculty at Lund University, the Swedish Society for Medical Research, the Royal Physiographic Society in Lund, the Foundations of Crafoord, Greta Johan Kock, and Alfred Österlund, the Swedish Rheumatism Association, and National Institutes of Health grant HL-49542.
Received for publication January 7, 1998; accepted April 8, 1998.
| Literature Cited |
|---|
|
|
|---|
Åkerström B (1992) Role of
1-microglobulin in immune response and inflammation. Folia Histochem Cytobiol 30:183-186[Medline]
Åkerström B, Bratt T, Enghild JJ (1995) Formation of the
1-microglobulin chromophore in mammalian and insect cellsa novel post-translational mechanism? FEBS Lett 362:50-54[Medline]
Åkerström B, Landin B (1985) Rat
1-microglobulin. Purification from urine and synthesis by hepatocyte monolayers. Eur J Biochem 146:353-358[Medline]
Åkerström B, Lögdberg L (1990) An intriguing member of the lipocalin protein family:
1-microglobulin. Trends Biochem Sci 15:240-243[Medline]
Berggård T, Thelin N, Falkenberg C, Enghild JJ, Åkerström B (1997) Prothrombin, albumin and immunoglobulin A form covalent complexes with
1-microglobulin in human plasma. Eur J Biochem 245:676-683[Medline]
Blom A, Pertoft H, Fries E (1995) Inter-
-inhibitor is required for the formation of the hyaluronan-containing coat on fibroblasts and mesotheliel cells. J Biol Chem 270:9698-9701
Bouic P, Vincent C, Revillard JP (1984) Immunohistological localization of
1-microglobulin in normal rat tissues. J Histochem Cytochem 32:717-723[Abstract]
Bratt T, Cedervall T, Åkerström B (1994) Processing and secretion of rat
1-microglobulin-bikunin expressed in eukaryotic cell-lines. FEBS Lett 354:57-61[Medline]
Bratt T, Olsson H, Sjöberg EM, Jergil B, Åkerström B (1993) Cleavage of the
1-microglobulin-bikunin precursor in the Golgi apparatus of rat liver cells. Biochim Biophys Acta 1157:147-154[Medline]
Bury A (1981) Evaluation of three sodium dodecyl sulphate-polyacrylamide gel electrophoresis buffer systems. J Chromatogr 213:491-500
Campbell RD, Law ASK (1992) C4 Complement protein. In Haeberli A, ed. Human Protein Data. Install 1. Weinheim, VCH Verlag
Chan P, Risler J-L, Raguenez G, Salier J-P (1995) The three heavy chain precursors for inter-
-inhibitor family in mouse: new members of the multicopper oxidase protein group with differential transcription in liver and brain. Biochem J 306:505-512
Chen L, Mao SJT, Larsen WJ (1992) Identification of a factor in fetal bovine serum that stabilizes the cumulus extracellular matrix. A role for a member of the inter-
-trypsin inhibitor family. J Biol Chem 267:12380-12386
Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159[Medline]
Cowan SW, Newcomer ME, Jones TA (1990) Crystallographic refinement of human serum retinol-binding protein at 2Å resolution. Proteins Struct Funct Genet 8:44-61[Medline]
Diarra-Mehrpour M, Bourguignon J, Sesboue R, Salier J-P, Leveillard T, Martin J-P (1990) Structural analysis of the human inter-
-trypsin inhibitor light-chain gene. Eur J Biochem 191:131-139[Medline]
Ekström B, Berggård I (1977) Human
1-microglobulin. Purification procedure, chemical and physicochemical properties. J Biol Chem 252:8084-8087
Ekström B, Peterson PA, Berggård I (1975) A urinary and plasma
glycoprotein of low molecular weight: isolation and some properties. Biochem Biophys Res Commun 65:1427-1433[Medline]
Enghild JJ, Salvesen G, Thøgersen IB, Pizzo SV (1989) Analysis of inter-
-trypsin inhibitor and a novel trypsin inhibitor, pre-
-trypsin inhibitor, from human plasma: polypeptide chain stoichiometry and assembly by glycan. J Biol Chem 264:11428-11435
Falkenberg C, Allhorn M, Thøgersen IB, Valnickova Z, Pizzo SV, Salvesen GS, Åkerström B, Enghild JJ (1995)
1-microglobulin destroys the proteinase inhibitory activity of
-inhibitor-3 by complex formation. J Biol Chem 270:4478-4483
Falkenberg C, Blom A, Fries E, Ekström G, Åkerström B (1997)
1-microglobulin and bikunin in rats with collagen II-induced arthritis: plasma levels and liver mRNA contents. Scand J Immunol 46:122-128[Medline]
Falkenberg C, Enghild JJ, Thøgersen IB, Salvesen G, Åkerström B (1994) Fibronectin
1-microglobulin complex in rat plasma. Isolation and characterization. Biochem J 301:745-751
Falkenberg C, Grubb A, Åkerström B (1990) Isolation of rat serum
1-microglobulin. Identification of a complex with
1-inhibitor-3, a rat
2-macroglobulin homologue. J Biol Chem 265:16150-16157
Flower DR (1996) The lipocalin protein family: structure and function. Biochem J 318:10-14
Grubb A, Lopez C, Tejler L, Mendez E (1983) Isolation of human complex-forming glycoprotein, heterogeneous in charge (protein HC), and its IgA-complex from human plasma. J Biol Chem 258:14698-14707
Hanley S, Powell R (1994) Sequence of a cDNA clone encoding the Atlantic salmon
1-microglobulin-bikunin protein. Gene 147:297-298[Medline]
Itoh H, Tomita M, Kobayashi T, Uchino H, Maruyama H, Nawa Y (1996) Expression of inter-
-trypsin inhibitor light chain (bikunin) in human pancreas. J Biochem 120:271-275
Kastern W, Björk L, Åkerström B (1986) Developmental and tissue-specific expression of
1-microglobulin mRNA in the rat. J Biol Chem 261:15070-15074
Kaumeyer JF, Polazzi JO, Kotick MP (1986) The mRNA for a proteinase inhibitor related to the HI-30 domain of inter-
-trypsin inhibitor also encodes
1-microglobulin (protein HC). Nucleic Acids Res 14:7839-7850
Lamontagne LR, Stadnyk AW, Gauldie J (1985) Synthesis of
1-protease inhibitor by resident and activated mouse alveolar macrophages. Am Rev Respir Dis 131:321-325[Medline]
Leaver MJ, Wright J, George SG (1994) Conservation of the tandem arrangement of
1-microglobulin/bikunin mRNA: cloning of a cDNA from plaice (Pleuronectes platessa). Comp Biochem Physiol 108B:275-281
Lindqvist A, Bratt T, Altieri M, Karsen W, Åkerström B (1992) Rat
1-microglobulin. Co-expression in liver with the light chain of inter-
-trypsin inhibitor. Biochim Biophys Acta 1130:63-67[Medline]
Matsudaira P (1987) Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J Biol Chem 262:10035-10038
McKeehan WL, Sakagami Y, Hoshi H, McKeehan KA (1986) Two apparent human endothelial cell growth factors from human hepatoma cells are tumor-associated proteinase inhibitors. J Biol Chem 261:5378-5383
Milde P, Merke J, Ritz E, Haussler MR, Rauterberg EW (1989) Immunohistochemical detection of 1,25-dihydroxyvitamin D3 receptors and estrogen receptors by monoclonal antibodies: comparison of four immunoperoxidase methods. J Histochem Cytochem 37:1609-1617[Abstract]
Oury TD, Chang LY, Marklund SL, Day BJ, Crapo JD (1994) Immunocytochemical localization of extracellular superoxide dismutase in human lung. Lab Invest 70:889-898[Medline]
Odum L, Nielsen HW (1994) Human protein HC (
1-microglobulin) and inter-
-trypsin inhibitor in connective tissue. Histochem J 26:799-803[Medline]
Odum L, Nielsen HW (1997) Bikunin and
1-microglobulin in human zona pellucida and connective tissue. Histochem J 29:199-203[Medline]
Papiz MZ, Sawyer L, Eliopoulos EE, North ACT, Findlay JBC, Sivprasadarao A, Jones TA, Newcomer ME, Kraulis PJ (1986) The structure of ß-lactoglobulin and its similarity to plasma retinol-binding protein. Nature 423:373-385
Perry JK, Scott GK, Tse CA (1994) Modulation of proliferation of cultured human cells by urinary trypsin inhibitor. Biochim Biophys Acta 1221:145-152[Medline]
Randell SH, Comment CE, Ramaekers FCS, Nettesheim P (1991) Properties of rat tracheal epithelial cells separated based on expression of cell surface
-galactosyl end groups. Am J Respir Cell Mol Biol 4:544-554
Salier J-P, Chan P, Raguenez G, Zwingman T, Erickson RP (1993) Developmentally regulated transcription of the four liver-specific genes for inter-
-inhibitor family in mouse. Biochem J 296:85-91
Salier J-P, Diarra-Mehrpour M, Sesboue R, Bourguignon J, Benarous R, Ohkubo I, Kurachi S, Kurachi K, Martin JP (1987) Isolation and characterization of cDNAs encoding the heavy chain of human inter-
-trypsin inhibitor (I
TI): unambiguous evidence for multipolypeptide chain structure of IaTI. Proc Natl Acad Sci USA 84:8272-8276
Strober W, Waldmann TA (1974) The role of the kidney in the metabolism of plasma proteins. Nephron 13:35-66[Medline]
Tavakkol A (1991) Molecular cloning of porcine
1-microglobulin/HI-30 reveals developmental and tissue-specific expression of two variant messenger ribonucleic acids. Biochim Biophys Acta 1088:47-56[Medline]
Tejler L, Eriksson S, Grubb A, Åstedt B (1978) Production of protein HC by human fetal liver explants. Biochim Biophys Acta 542:506-514[Medline]
Tejler L, Grubb A (1976) A complex-forming glycoprotein heterogeneous in charge and present in human plasma, urine and cerebrospinal fluid. Biochim Biophys Acta 439:82-94[Medline]
Thøgersen IB, Enghild JJ (1995) Biosynthesis of bikunin proteins in the human carcinoma cell line Hep G2 and in primary human hepatocytes. J Biol Chem 270:18700-18709
Vetr H, Gebhard W (1990) Structure of the human
1-microglobulin-bikunin gene. Biol Chem Hoppe Seyler 371:1185-1196[Medline]
This article has been cited by other articles:
![]() |
B. Akerstrom, G. J. Maghzal, C. C. Winterbourn, and A. J. Kettle The Lipocalin {alpha}1-Microglobulin Has Radical Scavenging Activity J. Biol. Chem., October 26, 2007; 282(43): 31493 - 31503. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Surjit, R. Oberoi, R. Kumar, and S. K. Lal Enhanced {alpha}1 Microglobulin Secretion from Hepatitis E Virus ORF3-expressing Human Hepatoma Cells Is Mediated by the Tumor Susceptibility Gene 101 J. Biol. Chem., March 24, 2006; 281(12): 8135 - 8142. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sala, M. Campagnoli, E. Perani, A. Romano, S. Labo, E. Monzani, L. Minchiotti, and M. Galliano Human {alpha}-1-Microglobulin Is Covalently Bound to Kynurenine-derived Chromophores J. Biol. Chem., December 3, 2004; 279(49): 51033 - 51041. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tyagi, M. Surjit, A. K. Roy, S. Jameel, and S. K. Lal The ORF3 Protein of Hepatitis E Virus Interacts with Liver-specific {alpha}1-Microglobulin and Its Precursor {alpha}1-Microglobulin/Bikunin Precursor (AMBP) and Expedites Their Export from the Hepatocyte J. Biol. Chem., July 9, 2004; 279(28): 29308 - 29319. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Allhorn, T. Berggard, J. Nordberg, M. L. Olsson, and B. Akerstrom Processing of the lipocalin alpha 1-microglobulin by hemoglobin induces heme-binding and heme-degradation properties Blood, March 15, 2002; 99(6): 1894 - 1901. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Lögdberg, B. Åkerström, and S. Badve Tissue Distribution of the Lipocalin Alpha-1 Microglobulin in the Developing Human Fetus J. Histochem. Cytochem., November 1, 2000; 48(11): 1545 - 1552. [Abstract] [Full Text] |
||||
![]() |
L. Wester, J. Fast, T. Labuda, T. Cedervall, K. Wingardh, T. Olofsson, and B. Akerstrom Carbohydrate groups of {alpha}1-microglobulin are important for secretion and tissue localization but not for immunological properties Glycobiology, September 1, 2000; 10(9): 891 - 900. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Guidelines | Subscriptions | About | exPRESS - Current - Archive | Business Information | Contact |